MCP-2→Deoxyribonuclease I→Interferon-gamma→poly-ADP-ribose

• 9119400(MCP-2): The human MCP-2 gene (SCYA8): cloning, sequence analysis, tissue expression, and assignment to the CC chemokine gene contig on chromosome 17q11.2.

  The amplified genomic MCP-2 fragment was used to isolate an MCP-2 cosmid from which the gene sequence was determined.

• 3934669(Deoxyribonuclease I): Regulation of expression of the human interferon gamma gene.

  The sequence AAGTGTAATTTTTTGAGTTTCTTTT , which is directly in the intronic hypersensitive area of IFN-gamma , is 83 % homologous to a nearly identical sequence in the 5 ' flanking region of the interleukin 2 gene.

• 10457887(Interferon-gamma): Mutation screening of the interferon-gamma gene as a candidate gene for multiple sclerosis.

  The interferon-gamma gene is highly conserved and changes in IFN-gamma expression are probably due to the influence of regulatory factors on gene transcription , rather than gene polymorphisms.

• 9417885(poly-ADP-ribose): Interferon-gamma inhibits insulin release and induces cell death in the pancreatic beta-cell line INS-1 independently of nitric oxide production.

  These effects were not mediated by nitric oxide (NO) , since IFN-gamma failed to induce nitric oxide synthase and NO production.